Journal: Leukemia

Article Title: Grb10 is involved in BCR-ABL-positive leukemia in mice.

doi: 10.1038/leu.2014.283

Figure Lengend Snippet: Figure 1. A retroviral vector system enabling Grb10 downregulation in every BCR-ABL-expressing cell. (a,b) Grb10 upregulation by BCR-ABL expression. BM cells from 5-FU pretreated donor Balb/C mice were retrovirally infected with MIG empty vector or MIG BCR-ABL. Cells were cultivated for 6 days in growth factor supplemented BBMM medium and starved overnight in 3% fetal calf serum containing medium without cytokines before analysis by quantitative real-time (qRT)-PCR (a). Grb10 expression levels were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and analysis was performed in duplicate. For western blot analyses (b) BM was cultured for 3 days after retroviral infection without cytokines (in case of MIG BCR-ABL) and with cytokines (in case of MIG empty), harvested and subjected to immunoblotting as indicated. (c) Western blot analysis of NIH/3T3 cells transduced with different Grb10 miRs in pLMP after puromycin selection. Because of efficient knockdown all further experiments were performed with Grb10 miR1. (d) Schematic representation of the single-vector design of pMmiRTOI-BCR-ABL. BCR-ABL and a miR30-based TOI-specific shRNA are expressed from the same RNA Pol II promoter long terminal repeat. EGFP is expressed via an internal ribosomal entry site (IRES). The DNA is transcribed by RNA Pol II resulting in one unique mRNA transcript encoding for target-specific miR, oncogene and EGFP as a fluorescent marker. Dicer processes miR30 sequence of the transcript or ribosomes initiate translation of the oncogene and EGFP. Provirus layouts are shown with open arrows indicating active promoters and two inverted block arrows representing shRNA stem sequence. (e) NIH/3T3 cells retrovirally infected with pMmiRGrb10/2-BCR- ABL or pMmiRCtrl-BCR-ABL construct. (f) 32D cells or 5-FU-enriched mouse BM-derived progenitor cells were infected either with pMmiRCtrl- BCR-ABL or pMmiRGrb10/2-BCR-ABL retrovirus. Expression levels of Grb10 were analyzed by quantitative real time PCR in EGFP cells 5 days after transduction. Results were normalized to the housekeeping gene GAPDH.

Article Snippet: Oligonucleotide sequence serving as PCR template was: 5′-TGCTGTTGACAGTGAGCGACACAGGATCATTAAACAGC AATAGTGAAGCCACAGATGTATTGCTGTTTAATGATCCTGTGGTGCCTACTGCC TCGGA-3′ Cell culture The IL-3-dependent murine myeloid cell line 32D and the IL-3-dependent mouse pro-B cell line Ba/F3 (DSMZ, Braunschweig, Germany) were cultured in RPMI 1640 (PAA Laboratories, Pasching, Austria) supplemented with 10% fetal calf serum (PAA Laboratories), 2 ng/ml IL-3, penicillin/streptomycin and L-glutamine.

Techniques: Retroviral, Plasmid Preparation, Expressing, Infection, Quantitative RT-PCR, Western Blot, Cell Culture, Transduction, Selection, Knockdown, shRNA, Marker, Sequencing, Blocking Assay, Construct, Derivative Assay, Real-time Polymerase Chain Reaction

Journal: Oncotarget

Article Title: Paradoxical counteraction by imatinib against cell death in myeloid progenitor 32D cells expressing p210BCR-ABL

doi: 10.18632/oncotarget.25849

Figure Lengend Snippet: (A) 32D/TetOff-p210 cells were Tet-supplied or depleted and then cultured for 48 h in the presence or absence of imatinib (1 μM). WCL were subjected to immunoblotting. The values of relative band intensity versus the Tet (+) control were shown below each panel. Data are representative of three independent experiments. (B) 32D/TetOff-p210 cells or parental 32D cells were Tet-supplied or depleted and then cultured with IL-3 supplement for 48 h in the presence or absence of imatinib (1 μM). Cell viability was determined by WST-8 assay. * P < 0.01, ** P < 0.001. Data are shown as mean ± SEM ( n = 6) and are representative of three independent experiments. NS indicates no significant difference. (C) 32D/TetOff-p210 cells were Tet-supplied or depleted and then cultured for 96 h in the presence or absence of imatinib (1 μM). Cells were double-stained with annexin V and PI and analyzed by flow cytometry. The proportion of cell population with the representative data is shown in each panel. Four independent double-staining experiments were performed and statistical analysis was executed. * P < 0.01, ** P < 0.001. Data are shown as mean ± SEM ( n = 4).

Article Snippet: Mouse myeloid progenitor 32D cells were pharchased from RIKEN BioResouce Centaer Cell Bank (RBRC-RCB1145; Tsukuba, Ibaraki, Japan) and cultured in RPMI1640 supplemented with 10%(v/v) FBS and 10%(v/v) IL-3 culture supplement (Corning, NY, USA), defined as the 32D growth media, at 37°C under 5% CO2 in air.

Techniques: Cell Culture, Western Blot, Control, Staining, Flow Cytometry, Double Staining

Journal: Oncotarget

Article Title: Paradoxical counteraction by imatinib against cell death in myeloid progenitor 32D cells expressing p210BCR-ABL

doi: 10.18632/oncotarget.25849

Figure Lengend Snippet: (A) 32D/TetOff-p210 cells were Tet-depleted and then cultured for 48 h. WCL were subjected to immunoblotting. Bands were visualized by probing with antibodies against caspase-1 p10, cleaved caspase-3 or cleaved PARP. (B) 32D/TetOff-p210 cells were Tet-depleted or supplied and then cultured in the presence or absence of imatinib (1 μM) for 96 h and then incubated with FLICA 660 active caspase-1 or caspase-3 detection probe and analyzed by flow cytometry. The merged histogram (solid line) with non-stain control (dashed line) is shown in each panel. The proportion of FLICA-positive cell population max is shown in each panel. Three independent FLICA caspase-1/3 assays were performed, and statistical analysis was executed, as shown in lower graphs. * P < 0.05, ** P < 0.01. Data are shown as mean ± SEM ( n = 3).

Article Snippet: Mouse myeloid progenitor 32D cells were pharchased from RIKEN BioResouce Centaer Cell Bank (RBRC-RCB1145; Tsukuba, Ibaraki, Japan) and cultured in RPMI1640 supplemented with 10%(v/v) FBS and 10%(v/v) IL-3 culture supplement (Corning, NY, USA), defined as the 32D growth media, at 37°C under 5% CO2 in air.

Techniques: Cell Culture, Western Blot, Incubation, Flow Cytometry, Staining, Control

Journal: Oncotarget

Article Title: Paradoxical counteraction by imatinib against cell death in myeloid progenitor 32D cells expressing p210BCR-ABL

doi: 10.18632/oncotarget.25849

Figure Lengend Snippet: 32D/TetOff-p210 cells or parental 32D cells were Tet-supplied or depleted and then cultured with IL-3 supplement for 96 h to collect the culture supernatant and WCL. (A) ELISA was performed to determine concentration of IL-1β and TNF-α in the culture supernatant. * P < 0.001, # P < 0.05. Data are shown as mean ± SEM ( n = 3) and are representative of three independent experiments. ND indicates not detected (under the detection limit). NS indicates no significant difference. (B) ELISA was performed to determine concentration of S100A8/A9 in the culture supernatant. * P < 0.05. Data are shown as mean ± SEM ( n = 3). ND indicates not detected (under the detection limit). WCL were subjected to immunoblotting. Bands were visualized by probing with antibodies against S100A8, S100A9 or actin. The values of relative band intensity versus the Tet (+) control are shown under each panel. (C) ELISA was performed to determine concentration of S100A8/A9 in the plasma of 8-month-old WT ( n = 7) and BCR-ABL TG ( n = 9) mice. Data are shown as mean ± SEM. * P < 0.05. (D) Expressions of both S100a8 and S100a9 in the spleen of 8-month-old WT ( n = 5) and BCR-ABL TG ( n = 6) mice were determined by quantitative RT-PCR. Data are shown as mean ± SEM. * P < 0.005. Statistical significance was evaluated by Mann–Whitney U test.

Article Snippet: Mouse myeloid progenitor 32D cells were pharchased from RIKEN BioResouce Centaer Cell Bank (RBRC-RCB1145; Tsukuba, Ibaraki, Japan) and cultured in RPMI1640 supplemented with 10%(v/v) FBS and 10%(v/v) IL-3 culture supplement (Corning, NY, USA), defined as the 32D growth media, at 37°C under 5% CO2 in air.

Techniques: Cell Culture, Enzyme-linked Immunosorbent Assay, Concentration Assay, Western Blot, Control, Clinical Proteomics, Quantitative RT-PCR, MANN-WHITNEY

Journal: Oncotarget

Article Title: Paradoxical counteraction by imatinib against cell death in myeloid progenitor 32D cells expressing p210BCR-ABL

doi: 10.18632/oncotarget.25849

Figure Lengend Snippet: 32D/TetOff-p210 cells were Tet-supplied or depleted and then cultured in the presence or absence of imatinib (1 μM) for 96 h. (A) Giemsa staining was performed. Cells with segmented nuclei (indicated by arrows) are shown in each panel. Scale bar, 10 μm. (B) Cells were triple-stained with anti-CD11b-BV421, anti-Ly6C-APC, and anti-Ly6G-PE, or isotype anti-rat IgG2b-BV421, anti-rat IgM-APC, and anti-rat IgG2a-PE. Stained cells were analyzed by flow cytometry. The obtained data were processed by selection of PI - and CD11b + cell population, and then the cell surface expression of Ly6C and Ly6G within the CD11b + cell population was analyzed. Numbers in the plots indicate the percentages of gated cells. (C) Three independent triple-staining experiments, as exemplified in panel B, were performed, and statistical analysis was executed. * P < 0.01. Data are shown as mean ± SEM ( n = 3).

Article Snippet: Mouse myeloid progenitor 32D cells were pharchased from RIKEN BioResouce Centaer Cell Bank (RBRC-RCB1145; Tsukuba, Ibaraki, Japan) and cultured in RPMI1640 supplemented with 10%(v/v) FBS and 10%(v/v) IL-3 culture supplement (Corning, NY, USA), defined as the 32D growth media, at 37°C under 5% CO2 in air.

Techniques: Cell Culture, Staining, Flow Cytometry, Selection, Expressing

Journal: Immunity

Article Title: Autophagy-Dependent Generation of Free Fatty Acids Is Critical for Normal Neutrophil Differentiation

doi: 10.1016/j.immuni.2017.08.005

Figure Lengend Snippet:

Article Snippet: 32D-cl3 (32D) myeloblast cells, RRID CVCL_0119, are derived from Mus musculus , were purchased from ATCC and cultured in RPMI 1640 with 10% FCS, 2 mM L-glutamine,100 U/ml Pen-Strep, and 10 ng/ml IL-3 at 37°C, 5% CO 2 .

Techniques: Virus, Recombinant, Giemsa Stain, Labeling, Gene Expression, ATP Bioluminescent Assay, Cell Based Assay, Software

Journal: PLoS ONE

Article Title: Aciculatin Inhibits Granulocyte Colony-Stimulating Factor Production by Human Interleukin 1β-Stimulated Fibroblast-Like Synoviocytes

doi: 10.1371/journal.pone.0042389

Figure Lengend Snippet: (A, C, and D) FLS were incubated with 0, 1, 3, or 10 µM aciculatin (A1, A3, and A10) for 30 min, and then for 24 h with 10 ng/mL of IL-1β in the continued presence of aciculatin. Whole cell extracts were then prepared for western blot analysis for the indicated proteins (A and C); equal amounts of cell culture media (“conditioned medium”) were collected and concentrated 10-fold (v/v) (lanes 1–4) or PBS only (lane 5), and then immunoprecipitated with 1 µg of anti-G-CSF antibody, followed by immunoblot analysis using anti-G-CSF antibody or anti-β-actin antibody (as an internal control) (D). (B) FLS were incubated with 0 or 10 µM aciculatin for 30 min, and then for 1 h with 10 ng/mL of IL-1β in the continued presence of aciculatin. The DNA binding activity of the nuclear extracts was then examined in an electrophoretic mobility shift assay using a specific STAT3 DNA probe. (E) Ten-fold concentrated conditioned medium was prepared from FLS incubated with or without aciculatin, and then with IL-1β as in (D), or with IL-1β plus an anti-G-CSF antibody. 32Dcl3 cells were incubated for 10 days with a medium containing 50% of these different conditioned mediums. The cells were then were subjected to Wright-Giemsa staining to detect neutrophils (top row) or washed twice with PBS, incubated at 4°C for 45 min with anti-CD11b FITC-conjugated and anti-CD11a/CD18 PE-conjugated antibodies, and their fluorescence was analyzed by FACScan flow cytometry (bottom row). Magnification = ×100; scale bar = 20 µm. In (A) and (C), the extents of indicated proteins expression were quantitated using a densitometer with the Image-Pro plus software, and the relative levels were calculated as the ratios of proteins to GAPDH or β-actin protein levels. The results are expressed as the mean ± SEM, with n = 3. * p <0.05 and ** p <0.01 compared with the control group; # p <0.05 and ## p <0.01 for the comparisons of the groups indicated.

Article Snippet: Mouse myelomonocytic leukemia WEHI-3 cells and mouse bone marrow 32Dcl3 cells were purchased from the Bioresource Collection and Research Center (Hsinchu, Taiwan).

Techniques: Incubation, Western Blot, Cell Culture, Immunoprecipitation, Control, Binding Assay, Activity Assay, Electrophoretic Mobility Shift Assay, Staining, Fluorescence, Flow Cytometry, Expressing, Software